DERL3 cloning plasmid

DERL3 cloning plasmid

Numer katalogowy: 399-CSB-CL836283HU-10ug

Kategoria produktu: Biznes i przemysł > Badania naukowe i laboratoryjne

Sprzedawca:

Cusabio Gentaur

Rozmiar: 10ug
Dostępność: Na zamówienie
Cena: 0.01 PLN*
DERL3 cloning plasmid
DERL3 cloning plasmid

Numer kat.: / Rozmiar: / Cena: PLN (bez podatku VAT)

Inquiry cart
1
Adres Email: | Edit
2
Szczegóły zapytania
DERL3 cloning plasmid
DERL3 cloning plasmid

Numer kat.: / Rozmiar: / Cena: PLN (bez podatku VAT)

3
Inquiry cart
* Zapytaj o ofertę, aby otrzymać aktualną ofertę w 24h.

A cloning plasmid for the DERL3 gene.

Dodatkowe informacje:


  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 708
  • Sequence: atggcgtggcagggactagcggccgagttcctgcaggtgccggcggtgacgcgggcttacaccgcagcctgtgtcctcaccaccgccgcggtgcagctggagctcctcagcccctttcaactctacttcaacccgcaccttgtgttccggaagttccaggtctggaggctcgtcaccaacttcctcttcttcgggcccctgggattcagcttcttcttcaacatgctcttcgtgttccgctactgccgcatgctggaagagggctccttccgcggccgcacggccgacttcgtcttcatgtttctcttcgggggcgtccttatgaccctgctgggactcctgggcagcctgttcttcctgggccaggccctcatggccatgctggtgtacgtgtggagccgccgcagccctcgggtgagggtcaacttcttcggcctgctcactttccaggcaccgttcctgccttgggcgctcatgggcttctcgctgctgctgggcaactccatcctcgtggacctgctggggattgcggtgggccatatctactacttcctggaggacgtcttccccaaccagcctggaggcaagaggctcctgcagacccctggcttcctaaagctgctcctggatgcccctgcagaagaccccaattacctgcccctccctgaggaacagccaggaccccatctgccacccccgcagcagtga

Specyfikacja/Zawartość:


  • Gene name: DERL3
  • Gene ID: 91319
  • Accession number: BC057830
  • Vector: pUC

Wysyłka i przechowywanie:


Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.

Inne:


For research use only.

0 opinie o DERL3 cloning plasmid

Dodaj opinię

Twój adres e-mail niie będzie upubliczniony.

12345